Articles · Farm

THE FASCINATING FACTS OF HONEY BEES

THE FASCINATING FACTS OF HONEY BEES

Did you know that Honey bees are the only insect that produce food eaten by man? Or that honey is the only food that contains all the substances to sustain life? And that it takes a bee 1,000 flowers to make a spoonful of honey?

IMGP1059.JPG

A lot of people think that the “bumble bee” produces honey. Drawings, children’s books, and TV imitations portray this furry insect as the one who creates that delicious sweet substance. But they are completely wrong. Honey bees are mid-brown in color; a very medium sized insect. They are amazing little creatures. Their wings beat 200 times a second. That’s as much as some species of humming birds!

IMG_0456
IMG_0460

Body parts: Honey bees have 6 legs, 2 compound eyes made up of thousands of tiny lenses (one on each side of the head), 3 simple eyes on the top of the head, 2 pairs of wings, a nectar pouch, and a stomach.

Bees are known as a super organism. There are 20,000 to 60,000 bees and one queen in each colony. They all separate themselves instinctively into their roles as part of the hive. The types of bees are put into three groups; Worker bees, Drones, and the Queen. Worker bees are always female. They do all the work; collecting nectar, nurturing the young, making honey, feeding the queen, and escorting the queen in the egg laying process. They live for six weeks.

The drones are the male bees. They are weigh more than the worker bees. Their only job is to mate. They are so lazy that the worker bees feed them and, when food is scarce, the workers force the drones out of hive. This usually happens in winter.

IMGP9956.JPG

The queen is the reproduction unit. She can live up to 5 years and lays 2,500 eggs a day. That’s 4,562,500 eggs in her lifetime. That’s a lot of bees. If the queen lays some eggs using her stored sperm, then all those eggs will be female. If she lays an unfertilized egg, then that egg will be male.

Worker bees can become many different things and will throughout their lifetime. They will move from being a: nurse and house bee, undertaker, architect, cleaner, organizer, honey maker, queen’s attendant, forager, and a guard bee.

IMGP4283.JPG

Did you know the honey bee’s genome has been completely decoded? Letters stand for the bases of DNA structures such as Adenine, Guanine, Cytosine, and Thymine. A sequence of letters translates into protein building blocks. Here is a sample of what a genome used by honeybees to build elements of the royal jelly looks like:

AGTTCATCATTTTATCTTCCAAAACTTCAGAAGCAAATCCAGTCGAAGAGACCCCGCAAGACGAATGGGGAGGGATTCGGCGAGATTGGTCGTCGGG

And the list just keeps going on…..for pages!

There is so much about honey bees that amazes us. They are so interesting and bring a wonderful food to our table. By learning and understanding bees, we can take care of them much better when they are in our hands.

honeycomb in jars.jpg
Advertisements

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google photo

You are commenting using your Google account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s